sgrna sequences targeting cbx2 Search Results


N/A
Transfect cells with our CRISPR plasmids with Cas9 and sgRNA for human, mouse, and rat. Search our database of more than 45,000 human, mouse, and rat genes for genome editing using CRISPR. sgRNA expression plasmids
  Buy from Supplier

86
Genechem sgrna sequences targeting cbx2
a Representative IHC images of <t>CBX2</t> staining (nuclear, brown) from the high ( N = 67) and the low ( N = 56) CBX2 groups of EOC patients with a median score of 6 as the cut-off value. Scale bar, 50 μm. b Kaplan-Meier plots showing the progression-free survival of 123 EOC and 101 HGSOC patients with tumors expressing high and low levels of CBX2 along with hazard ratios and P values (high vs. low, cox regression. c Violin plots presenting the IHC scores of CBX2 in platinum-resistant and -sensitive EOC and HGSOC patients (Mann-Whitney test). d Cell viability in the CBX2 knockdown cells compared with controls after gradient concentrations of cDDP treatment for 72 h detected by MTT assay. e Representative images and ( f ) quantification of colony formation assays for CRISPR-Cas9 CBX2 knockout OVCAR4 and CAOV3 cells compared with controls after indicated cDDP treatment for 14 days (unpaired two-tailed Student’s t test). g Quantification of colony formation assay for CBX2 over-expressed OVCAR4 and CAOV3 cells compared with controls after indicated cDDP treatment for 14 days (unpaired two-tailed Student’s t test). h Images of subcutaneous xenografts derived from CBX2-knockout and control CAOV3 cells treated with saline and cDDP ( N = 3). i Quantification of tumor volume and weight of the CBX2-knockout (CBX2 KO ) compared with the control groups (CBX2 NC ) upon treatment of cDDP (3 mg/kg, every other day) and saline on the day of sacrifice. j Quantification of IHC scores of CBX2, Ki-67, H2AX, and cleaved-caspase3 of tumor tissues from subcutaneous xenografts. Data represent mean ± SEM of at least three independent biological replicates. ns not significant, P > 0.05; * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001.
Sgrna Sequences Targeting Cbx2, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna+sequences+targeting+cbx2/cbx2+sequences+sgrna+targeting/pmc13039389-236-1-14
Average 86 stars, based on 1 article reviews
sgrna sequences targeting cbx2 - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

Image Search Results


a Representative IHC images of CBX2 staining (nuclear, brown) from the high ( N = 67) and the low ( N = 56) CBX2 groups of EOC patients with a median score of 6 as the cut-off value. Scale bar, 50 μm. b Kaplan-Meier plots showing the progression-free survival of 123 EOC and 101 HGSOC patients with tumors expressing high and low levels of CBX2 along with hazard ratios and P values (high vs. low, cox regression. c Violin plots presenting the IHC scores of CBX2 in platinum-resistant and -sensitive EOC and HGSOC patients (Mann-Whitney test). d Cell viability in the CBX2 knockdown cells compared with controls after gradient concentrations of cDDP treatment for 72 h detected by MTT assay. e Representative images and ( f ) quantification of colony formation assays for CRISPR-Cas9 CBX2 knockout OVCAR4 and CAOV3 cells compared with controls after indicated cDDP treatment for 14 days (unpaired two-tailed Student’s t test). g Quantification of colony formation assay for CBX2 over-expressed OVCAR4 and CAOV3 cells compared with controls after indicated cDDP treatment for 14 days (unpaired two-tailed Student’s t test). h Images of subcutaneous xenografts derived from CBX2-knockout and control CAOV3 cells treated with saline and cDDP ( N = 3). i Quantification of tumor volume and weight of the CBX2-knockout (CBX2 KO ) compared with the control groups (CBX2 NC ) upon treatment of cDDP (3 mg/kg, every other day) and saline on the day of sacrifice. j Quantification of IHC scores of CBX2, Ki-67, H2AX, and cleaved-caspase3 of tumor tissues from subcutaneous xenografts. Data represent mean ± SEM of at least three independent biological replicates. ns not significant, P > 0.05; * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001.

Journal: Cell Death & Disease

Article Title: CBX2 phase-separation contributes to homologous recombination repair and drug resistance in ovarian cancer

doi: 10.1038/s41419-026-08605-4

Figure Lengend Snippet: a Representative IHC images of CBX2 staining (nuclear, brown) from the high ( N = 67) and the low ( N = 56) CBX2 groups of EOC patients with a median score of 6 as the cut-off value. Scale bar, 50 μm. b Kaplan-Meier plots showing the progression-free survival of 123 EOC and 101 HGSOC patients with tumors expressing high and low levels of CBX2 along with hazard ratios and P values (high vs. low, cox regression. c Violin plots presenting the IHC scores of CBX2 in platinum-resistant and -sensitive EOC and HGSOC patients (Mann-Whitney test). d Cell viability in the CBX2 knockdown cells compared with controls after gradient concentrations of cDDP treatment for 72 h detected by MTT assay. e Representative images and ( f ) quantification of colony formation assays for CRISPR-Cas9 CBX2 knockout OVCAR4 and CAOV3 cells compared with controls after indicated cDDP treatment for 14 days (unpaired two-tailed Student’s t test). g Quantification of colony formation assay for CBX2 over-expressed OVCAR4 and CAOV3 cells compared with controls after indicated cDDP treatment for 14 days (unpaired two-tailed Student’s t test). h Images of subcutaneous xenografts derived from CBX2-knockout and control CAOV3 cells treated with saline and cDDP ( N = 3). i Quantification of tumor volume and weight of the CBX2-knockout (CBX2 KO ) compared with the control groups (CBX2 NC ) upon treatment of cDDP (3 mg/kg, every other day) and saline on the day of sacrifice. j Quantification of IHC scores of CBX2, Ki-67, H2AX, and cleaved-caspase3 of tumor tissues from subcutaneous xenografts. Data represent mean ± SEM of at least three independent biological replicates. ns not significant, P > 0.05; * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001.

Article Snippet: The sgRNA sequences targeting CBX2 (Sg859 5’-3’ ACCAGCCGCGCCACTTGACC, Sg861 5’-3’ GAGCTTGGAGCGCCGGCTGC) were synthesized by GeneChem (Shanghai, China).

Techniques: Staining, Expressing, MANN-WHITNEY, Knockdown, MTT Assay, CRISPR, Knock-Out, Two Tailed Test, Colony Assay, Derivative Assay, Control, Saline

a Representative images of the karyotype of CBX2 knockout (CBX2 KO ) and control (CBX2 NC ) cells. b Quantification of chromosomal breaks in CBX2 KO and CBX2 NC cells at metaphase (unpaired two-tailed Student’s t test). c Representative images and quantification ( d ) of γH2AX foci and ( e ) micronuclei staining performed in the CBX2 KO and the control OVCAR4 cells. Scale bar, 20 μm (unpaired two-tailed Student’s t test). f Representative images and ( g ) quantification of the tail moment of the neutral comet assay of the CBX2 KO and the control OVCAR4 cells treated with 15 μM cDDP or saline for 72 h (unpaired two-tailed Student’s t test). h Reactome GSEA enrichment score curves of chromatin-bound proteomics from the CBX2 KO OVRCAR4 cells compared to the control cells. i Volcano plots presenting up-regulated apoptosis-associated proteins and down-regulated DNA damage checkpoints in the CBX2 KO compared to the control OVCAR4 cells. j Schematic illustration of the HR/NHEJ reporter assay. k Quantification of the percentage of GFP/mCherry positive cells in the CBX2 KO and the control OVCAR4 cells through flow cytometry (one-way ANOVA). Data represent mean ± SEM of at least three independent biological replicates. ns not significant, * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001.

Journal: Cell Death & Disease

Article Title: CBX2 phase-separation contributes to homologous recombination repair and drug resistance in ovarian cancer

doi: 10.1038/s41419-026-08605-4

Figure Lengend Snippet: a Representative images of the karyotype of CBX2 knockout (CBX2 KO ) and control (CBX2 NC ) cells. b Quantification of chromosomal breaks in CBX2 KO and CBX2 NC cells at metaphase (unpaired two-tailed Student’s t test). c Representative images and quantification ( d ) of γH2AX foci and ( e ) micronuclei staining performed in the CBX2 KO and the control OVCAR4 cells. Scale bar, 20 μm (unpaired two-tailed Student’s t test). f Representative images and ( g ) quantification of the tail moment of the neutral comet assay of the CBX2 KO and the control OVCAR4 cells treated with 15 μM cDDP or saline for 72 h (unpaired two-tailed Student’s t test). h Reactome GSEA enrichment score curves of chromatin-bound proteomics from the CBX2 KO OVRCAR4 cells compared to the control cells. i Volcano plots presenting up-regulated apoptosis-associated proteins and down-regulated DNA damage checkpoints in the CBX2 KO compared to the control OVCAR4 cells. j Schematic illustration of the HR/NHEJ reporter assay. k Quantification of the percentage of GFP/mCherry positive cells in the CBX2 KO and the control OVCAR4 cells through flow cytometry (one-way ANOVA). Data represent mean ± SEM of at least three independent biological replicates. ns not significant, * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001.

Article Snippet: The sgRNA sequences targeting CBX2 (Sg859 5’-3’ ACCAGCCGCGCCACTTGACC, Sg861 5’-3’ GAGCTTGGAGCGCCGGCTGC) were synthesized by GeneChem (Shanghai, China).

Techniques: Knock-Out, Control, Two Tailed Test, Staining, Neutral Comet Assay, Saline, Reporter Assay, Flow Cytometry

a Representative confocal images of FRAP of EGFP signal in EGFP-tagged NC, CBX2-IDR WT , and CBX2-IDR Mut transfected CBX2 knock-out OVCAR4 cells (OVCAR4-CBX2 KO ) at pre-breaching (0 seconds), breaching (2 seconds), and post-breaching (122 seconds). Scale bar, 5 μm. b FRAP curves of EGFP signal in EGFP-tagged CBX2-IDR Mut and CBX2-IDR WT cells. c Percentage of mobility of CBX2 in CBX2-IDR Mut and CBX2-IDR WT cells. d Quantification of γH2AX foci and ( e ) micronuclei staining performed in EGFP-tagged NC, CBX2-IDR WT , and CBX2-IDR Mut cells. Scale bar, 20 μm (unpaired two-tailed Student’s t test). f Quantification of chromosomal breaks in EGFP-tagged NC, CBX2-IDR WT , and CBX2-IDR Mut cells treated with cDDP at metaphase (one-way ANOVA). g Quantification of the tail moment of the neutral comet assay of EGFP-tagged NC, CBX2-IDR WT , and CBX2-IDR Mut cells treated with 15 μM cDDP or saline for 72 h (unpaired two-tailed Student’s t test). h Cell viability in the EGFP-tagged NC, CBX2-IDR WT , and CBX2-IDR Mut cells after gradient concentrations of cDDP treatment for 72 h detected by MTT assay. i Quantification of colony formation assay for EGFP-tagged NC, CBX2-IDR WT , and CBX2-IDR Mut cells after indicated cDDP treatment for 14 days (unpaired two-tailed Student’s t test). j Quantification of the percentage of GFP/mCherry positive cells in the EGFP-tagged CBX2-IDR WT and CBX2-IDR Mut cells through flow cytometry (one-way ANOVA). k Tumor volume and ( l ) tumor weight of subcutaneous xenografts derived from EGFP-tagged CBX2-IDR WT and EGFP-CBX2-IDR Mut cells treated with saline, cDDP, oil and Niraparib. ( m ) and ( n ) IHC scores of CBX2, Ki-67, H2AX, and cleaved-caspase3 of tumor tissues from subcutaneous xenografts treated with saline, cDDP, oil and Niraparib. Data represent mean ± SEM of at least three independent biological replicates. ns not significant, * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001.

Journal: Cell Death & Disease

Article Title: CBX2 phase-separation contributes to homologous recombination repair and drug resistance in ovarian cancer

doi: 10.1038/s41419-026-08605-4

Figure Lengend Snippet: a Representative confocal images of FRAP of EGFP signal in EGFP-tagged NC, CBX2-IDR WT , and CBX2-IDR Mut transfected CBX2 knock-out OVCAR4 cells (OVCAR4-CBX2 KO ) at pre-breaching (0 seconds), breaching (2 seconds), and post-breaching (122 seconds). Scale bar, 5 μm. b FRAP curves of EGFP signal in EGFP-tagged CBX2-IDR Mut and CBX2-IDR WT cells. c Percentage of mobility of CBX2 in CBX2-IDR Mut and CBX2-IDR WT cells. d Quantification of γH2AX foci and ( e ) micronuclei staining performed in EGFP-tagged NC, CBX2-IDR WT , and CBX2-IDR Mut cells. Scale bar, 20 μm (unpaired two-tailed Student’s t test). f Quantification of chromosomal breaks in EGFP-tagged NC, CBX2-IDR WT , and CBX2-IDR Mut cells treated with cDDP at metaphase (one-way ANOVA). g Quantification of the tail moment of the neutral comet assay of EGFP-tagged NC, CBX2-IDR WT , and CBX2-IDR Mut cells treated with 15 μM cDDP or saline for 72 h (unpaired two-tailed Student’s t test). h Cell viability in the EGFP-tagged NC, CBX2-IDR WT , and CBX2-IDR Mut cells after gradient concentrations of cDDP treatment for 72 h detected by MTT assay. i Quantification of colony formation assay for EGFP-tagged NC, CBX2-IDR WT , and CBX2-IDR Mut cells after indicated cDDP treatment for 14 days (unpaired two-tailed Student’s t test). j Quantification of the percentage of GFP/mCherry positive cells in the EGFP-tagged CBX2-IDR WT and CBX2-IDR Mut cells through flow cytometry (one-way ANOVA). k Tumor volume and ( l ) tumor weight of subcutaneous xenografts derived from EGFP-tagged CBX2-IDR WT and EGFP-CBX2-IDR Mut cells treated with saline, cDDP, oil and Niraparib. ( m ) and ( n ) IHC scores of CBX2, Ki-67, H2AX, and cleaved-caspase3 of tumor tissues from subcutaneous xenografts treated with saline, cDDP, oil and Niraparib. Data represent mean ± SEM of at least three independent biological replicates. ns not significant, * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001.

Article Snippet: The sgRNA sequences targeting CBX2 (Sg859 5’-3’ ACCAGCCGCGCCACTTGACC, Sg861 5’-3’ GAGCTTGGAGCGCCGGCTGC) were synthesized by GeneChem (Shanghai, China).

Techniques: Transfection, Knock-Out, Staining, Two Tailed Test, Neutral Comet Assay, Saline, MTT Assay, Colony Assay, Flow Cytometry, Derivative Assay

a GSEA enrichment score curves of the gene expression alterations of EGFP-tagged CBX2-IDR Mut compared to CBX2-IDR WT cells upon treatment with 15 μM cDDP for 18 hours. ES, enrichment score; NES, normalized enrichment score; FDR, false discovery rate. b Bubble diagram showing changes between the chromatin-bound DDR-associated proteins among EGFP-tagged NC, CBX2-IDR WT , and CBX2-IDR Mut OVCAR4-CBX2 KO cells upon treatment with 15 μM cDDP for 18 hours through proteomic analysis. CNE, chromatin-bound nuclear extract. c Schematic diagram presenting chromatin-bound DSB repair proteins identified in ( b ). d Western blots of indicated DSB proteins in the CNE and WCL of EGFP-tagged NC, CBX2-IDR WT , and CBX2-IDR Mut OVCAR4-CBX2 KO cells. CNE, chromatin-bound nuclear extract; WCL, whole-cell lysate. e Schematic diagram presenting candidate CBX2 binding proteins detected in EGFP-tagged CBX2-IDR WT and CBX2-IDR Mut OVCAR4-CBX2 KO cells upon treatment with 15 μM cDDP for 18 hours through proteomic analysis. f Western blots of γH2AX, BRCA1, Rad51, PARP1, NUMA, H3K27me3, and CBX2 from lysate of input, CBX2-IP, and IgG derived from OVCAR4-CBX2 KO cells transfected with EGFP-tagged NC, CBX2-IDR WT , and CBX2-IDR Mut upon treatment with 15 μM cDDP for 18 hours. CBX2-IP, lysate co-immunoprecipitated with CBX2.

Journal: Cell Death & Disease

Article Title: CBX2 phase-separation contributes to homologous recombination repair and drug resistance in ovarian cancer

doi: 10.1038/s41419-026-08605-4

Figure Lengend Snippet: a GSEA enrichment score curves of the gene expression alterations of EGFP-tagged CBX2-IDR Mut compared to CBX2-IDR WT cells upon treatment with 15 μM cDDP for 18 hours. ES, enrichment score; NES, normalized enrichment score; FDR, false discovery rate. b Bubble diagram showing changes between the chromatin-bound DDR-associated proteins among EGFP-tagged NC, CBX2-IDR WT , and CBX2-IDR Mut OVCAR4-CBX2 KO cells upon treatment with 15 μM cDDP for 18 hours through proteomic analysis. CNE, chromatin-bound nuclear extract. c Schematic diagram presenting chromatin-bound DSB repair proteins identified in ( b ). d Western blots of indicated DSB proteins in the CNE and WCL of EGFP-tagged NC, CBX2-IDR WT , and CBX2-IDR Mut OVCAR4-CBX2 KO cells. CNE, chromatin-bound nuclear extract; WCL, whole-cell lysate. e Schematic diagram presenting candidate CBX2 binding proteins detected in EGFP-tagged CBX2-IDR WT and CBX2-IDR Mut OVCAR4-CBX2 KO cells upon treatment with 15 μM cDDP for 18 hours through proteomic analysis. f Western blots of γH2AX, BRCA1, Rad51, PARP1, NUMA, H3K27me3, and CBX2 from lysate of input, CBX2-IP, and IgG derived from OVCAR4-CBX2 KO cells transfected with EGFP-tagged NC, CBX2-IDR WT , and CBX2-IDR Mut upon treatment with 15 μM cDDP for 18 hours. CBX2-IP, lysate co-immunoprecipitated with CBX2.

Article Snippet: The sgRNA sequences targeting CBX2 (Sg859 5’-3’ ACCAGCCGCGCCACTTGACC, Sg861 5’-3’ GAGCTTGGAGCGCCGGCTGC) were synthesized by GeneChem (Shanghai, China).

Techniques: Gene Expression, Western Blot, Binding Assay, Derivative Assay, Transfection, Immunoprecipitation

a FRAP curves of EGFP signal in EGFP-tagged CBX2-IDR Mut and CBX2-IDR WT OVCAR4-CBX2 KO cells with mobile and dense CBX2 condensates treated with saline, cDDP, DMSO, Niraparib, and GSK126. b Representative images of CBX2 distribution pattern in EGFP-tagged CBX2-IDR Mut and CBX2-IDR WT OVCAR4-CBX2 KO cells treated with saline, cDDP, DMSO, Niraparib, and GSK126. Scale bar, 5 μm. c Quantification of the percentage of dense CBX2 condensates in cells with indicated compound treatment in live and ( d ) fixed cells. e Representative images of γH2AX, BRCA1, and 53BP1 foci in EGFP-tagged CBX2-IDR Mut and CBX2-IDR WT OVCAR4-CBX2 KO cells treated with saline, cDDP, DMSO, and Niraparib. Scale bar, 20 μm. Data represent mean ± SEM of at least three independent biological replicates. ns not significant, * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001.

Journal: Cell Death & Disease

Article Title: CBX2 phase-separation contributes to homologous recombination repair and drug resistance in ovarian cancer

doi: 10.1038/s41419-026-08605-4

Figure Lengend Snippet: a FRAP curves of EGFP signal in EGFP-tagged CBX2-IDR Mut and CBX2-IDR WT OVCAR4-CBX2 KO cells with mobile and dense CBX2 condensates treated with saline, cDDP, DMSO, Niraparib, and GSK126. b Representative images of CBX2 distribution pattern in EGFP-tagged CBX2-IDR Mut and CBX2-IDR WT OVCAR4-CBX2 KO cells treated with saline, cDDP, DMSO, Niraparib, and GSK126. Scale bar, 5 μm. c Quantification of the percentage of dense CBX2 condensates in cells with indicated compound treatment in live and ( d ) fixed cells. e Representative images of γH2AX, BRCA1, and 53BP1 foci in EGFP-tagged CBX2-IDR Mut and CBX2-IDR WT OVCAR4-CBX2 KO cells treated with saline, cDDP, DMSO, and Niraparib. Scale bar, 20 μm. Data represent mean ± SEM of at least three independent biological replicates. ns not significant, * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001.

Article Snippet: The sgRNA sequences targeting CBX2 (Sg859 5’-3’ ACCAGCCGCGCCACTTGACC, Sg861 5’-3’ GAGCTTGGAGCGCCGGCTGC) were synthesized by GeneChem (Shanghai, China).

Techniques: Saline

a Schematic illustration of the compound library screening and the rank of the compound with a percent difference in area under curve values (%AUC Diff ) in EGFP-tagged CBX2-IDR WT cells compared to CBX2-IDR Mut cells, more than 20% in the initial screen. b Waterfall plots of all the drugs ranked in the initial screen and ( c ) the validation screen. d Cell viability of EGFP-tagged NC, CBX2-IDR WT , and CBX2-IDR Mut OVCAR-CBX2 KO cells treated with gradient concentrations of Ibrutinib for 72 h evaluated by MTT assay. ( e ) Tumor volume and ( f ) tumor weight of subcutaneous xenografts derived from EGFP-tagged CBX2-IDR WT and CBX2-IDR Mut CAOV3-CBX2 KO cells treated with DMSO and Ibrutinib. g IHC scores of CBX2, Ki-67, H2AX, and cleaved-caspase3 of tumor tissues from subcutaneous xenografts. h Heatmap showing differential gene expression and ( i ) BTK-associated gene expression changes between the EGFP-tagged NC, CBX2-IDR WT , and CBX2-IDR Mut cells. j Quantification of the percentage of GFP/mCherry positive cells in parental OVCAR4 and CAOV3 cells transfected with the HR/NHEJ reporter system, exposed to the indicated concentrations of Ibrutinib by flow cytometry (one-way ANOVA). Data represent mean ± SEM of at least three independent biological replicates. ns not significant, * P < 0.05; ** P < 0.01; *** P < 0.001.

Journal: Cell Death & Disease

Article Title: CBX2 phase-separation contributes to homologous recombination repair and drug resistance in ovarian cancer

doi: 10.1038/s41419-026-08605-4

Figure Lengend Snippet: a Schematic illustration of the compound library screening and the rank of the compound with a percent difference in area under curve values (%AUC Diff ) in EGFP-tagged CBX2-IDR WT cells compared to CBX2-IDR Mut cells, more than 20% in the initial screen. b Waterfall plots of all the drugs ranked in the initial screen and ( c ) the validation screen. d Cell viability of EGFP-tagged NC, CBX2-IDR WT , and CBX2-IDR Mut OVCAR-CBX2 KO cells treated with gradient concentrations of Ibrutinib for 72 h evaluated by MTT assay. ( e ) Tumor volume and ( f ) tumor weight of subcutaneous xenografts derived from EGFP-tagged CBX2-IDR WT and CBX2-IDR Mut CAOV3-CBX2 KO cells treated with DMSO and Ibrutinib. g IHC scores of CBX2, Ki-67, H2AX, and cleaved-caspase3 of tumor tissues from subcutaneous xenografts. h Heatmap showing differential gene expression and ( i ) BTK-associated gene expression changes between the EGFP-tagged NC, CBX2-IDR WT , and CBX2-IDR Mut cells. j Quantification of the percentage of GFP/mCherry positive cells in parental OVCAR4 and CAOV3 cells transfected with the HR/NHEJ reporter system, exposed to the indicated concentrations of Ibrutinib by flow cytometry (one-way ANOVA). Data represent mean ± SEM of at least three independent biological replicates. ns not significant, * P < 0.05; ** P < 0.01; *** P < 0.001.

Article Snippet: The sgRNA sequences targeting CBX2 (Sg859 5’-3’ ACCAGCCGCGCCACTTGACC, Sg861 5’-3’ GAGCTTGGAGCGCCGGCTGC) were synthesized by GeneChem (Shanghai, China).

Techniques: Drug discovery, Biomarker Discovery, MTT Assay, Derivative Assay, Gene Expression, Transfection, Flow Cytometry

a Representative images of patients with non-condensate, condensate, and negative CBX2 patterns. Red, EpCAM; Green, CBX2; Blue, DAPI. Scale bar, 20 μm. b The Kaplan-Meier plot depicts the overall survival, and ( c ) progression-free survival of patients with all histologies and those with HGSOC presenting varying CBX2 positivity and patterns, and the corresponding hazard ratios (log-rank test, cox-regression). d Representative images of IHC staining of EpCAM, P53, PAX8, WT, and CBX2 of PDOs and their respective tissues of origin. Scale bar, 40 μm. e Representative images of PDOs derived from 8 patients before and after treatment with DMSO and Ibrutinib for 96 hours. Scale bar, 40 μm. f Viability of PDOs with high and low IHC score of CBX2 treated with DMSO and Ibrutinib for 96 h. PDO, patient-derived organoid (unpaired two-tailed Student’s t test). Data represent mean ± SEM of at least three independent biological replicates. ns not significant, * P < 0.05.

Journal: Cell Death & Disease

Article Title: CBX2 phase-separation contributes to homologous recombination repair and drug resistance in ovarian cancer

doi: 10.1038/s41419-026-08605-4

Figure Lengend Snippet: a Representative images of patients with non-condensate, condensate, and negative CBX2 patterns. Red, EpCAM; Green, CBX2; Blue, DAPI. Scale bar, 20 μm. b The Kaplan-Meier plot depicts the overall survival, and ( c ) progression-free survival of patients with all histologies and those with HGSOC presenting varying CBX2 positivity and patterns, and the corresponding hazard ratios (log-rank test, cox-regression). d Representative images of IHC staining of EpCAM, P53, PAX8, WT, and CBX2 of PDOs and their respective tissues of origin. Scale bar, 40 μm. e Representative images of PDOs derived from 8 patients before and after treatment with DMSO and Ibrutinib for 96 hours. Scale bar, 40 μm. f Viability of PDOs with high and low IHC score of CBX2 treated with DMSO and Ibrutinib for 96 h. PDO, patient-derived organoid (unpaired two-tailed Student’s t test). Data represent mean ± SEM of at least three independent biological replicates. ns not significant, * P < 0.05.

Article Snippet: The sgRNA sequences targeting CBX2 (Sg859 5’-3’ ACCAGCCGCGCCACTTGACC, Sg861 5’-3’ GAGCTTGGAGCGCCGGCTGC) were synthesized by GeneChem (Shanghai, China).

Techniques: Immunohistochemistry, Derivative Assay, Two Tailed Test